LAST home | LAST web service | CBRC home

LAST

AGATAGAAACCAACCTGGCTTACACCGGTTTGAACTCAGATCATGTAAGAATTTAAAAGTCGAACAGACTTAAAATTTGAACGGCTACACCCAAAATTAT
AGATAGAAACCGACCTGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACGAACCTTTAATAGCGGCTGCACCATCGGGAT
*********** ****** **** ***** ************* *** ** *****  ** ***** **  *   **   *  *      ***     **
Enter your "reference" sequence(s):
>mySeq1
catgctagtctttactgtatcgtaaaaaa
acgtagtgctagatgctagctcggg
>mySeq2
atctgatgctagatcgtacgtaaa


Or upload a file:
Enter your "query" sequence(s):
>mySeqX
catgctagtctttaccgtatcgtaaaaaa
cgtagggctagatgctagctcggg
>mySeqY
atctgatgctagatcgtacgtaaa


Or upload a file:

Example output

About the LAST web service

Advanced parameters (feel free to ignore these)

Alignment type:



Sequence type:



Query strand (ignored for proteins):



Lowercase:


Mask lowercase for initial matches:


Mask lowercase for extensions:










Upload a subset seed:











Upload a score matrix: