LAST home | LAST web service | CBRC home

About the LAST web service

This is a tool for aligning sequences, similar to BLAST 2 sequences. A nice feature of LAST is that it colour-codes the alignments by reliability. For example:

TGAAGTTAAAGGTATATGAATTCCAATTCTTAACCCCCCTATTAAACGAATATCTTG
TGAAGTGAGAGGTATGGTTTTGAGTAGTCCT------CCTATTTTTCGAATATCTTG
****** * ******     *    * ** *      ******   ***********
   probability > 0.999
   probability > 0.99
   probability > 0.95
   probability > 0.9
   probability > 0.5
   probability ≤ 0.5

Here, the yellow regions are so dissimilar that the correct alignment cannot be confidently inferred.

Another useful feature of LAST is that it can compare huge (vertebrate-genome-sized) datasets. Unfortunately, this only applies to the downloadable version of LAST, not the web service. The web service can just about handle bacterial genomes, but it will take a few minutes and the output will be large.

The "advanced parameters" are for experts only, so we won't bother to explain them :-). Experts can figure them out by reading the documents for the downloadable version of LAST, especially last-manual.txt.

Currently, we do not offer a database search service (e.g. match your queries to genomes stored on our server). This would require much more maintenance on our part. (Which genomes? Which versions?)

If you use LAST in your research, please cite one (or more) of the following publications:

Questions? Please send email to: last (ATmark) cbrc (dot) jp.